Home   Site Map   How to Cite   Contact
 
Japonica group cultivar Nip (Normal Condition)

Chromatin accessibility is a highly informative architecture feature that determined gene transcriptional regulation. In our SMOC, users could easily browse and predict the potential OCRs on targeted DNA region in rice genomes.

 

Type/Paste the gene sequence with FASTA format below:
 
   

Example:

>test

CGTCGCCGCCGTTGCCCGCCCTCCTCGCAGCGCCGCCGCCGCCGTTTGGCTGGGAGACTCCAGAAAGTCTCCTCGAGTGTTGATGCCCATTTCCAGGGCCTCCGAGCCACAGTTTCTGCCACAACGATGTGGCAGGCCAAAGGCTCTAGGGCCATGCTCAAAGAGTACTCCTTTGGTAAAAAAATACTCAACTTAGAAGTGAAAAATATGGAGAGAGTATTACTAAGGGCATCAGGCAATGAGGGTTCATGCAGGCCGTAAACCAGGGAGCAGGGGAGAAGCCCATGAGGCTGTTAGCTGATGGGCCTGTACGGTCTCGTGTGTACACAAATATTTGGGAAAAAAGTACACCGAAGGTCCCTC

Results

 
 

Welcome to eLab in CAAS
eLab located at Biotechnology Research Institute, Chinese Academy of Agricultural sciences, 12 Zhongguancun South Street, Beijing, China.

 
 
Copyright©2018 eLAbcaas.cn All rights reserved. Design by eLAbcaas.cn.