DNA 5mC has significant role in regulating gene expression and TE silencing in plants. 5mC has been located in all sequence contexts such as, CG, CHG and CHH (where H= A, T or C). In this SMEP, users could easily enquiry and predict the potential 5mC sites on targeted DNA regions.

Example:

>test

CCGGAGAGACAACGGGATCCAGGCGCCAGCGACGGATCCGGGATCTGCCGCCCACGACCCGAGTCATCGTTGGATCCACCACGTTGCCACTAGAGAATCTACCTGACATCCATTAGCTTTGATCCAAGAAAAAATTTGTAACAGGTATAAAATCACATCTTCATTAAAGTCAGCAGCCCACATCATCTCCAGGGCTGTTTTTCCCTCTAGCAAAAAGAACAGGTGCCAG

Welcome to eLab in CAAS
eLab located at Biotechnology Research Institute, Chinese Academy of Agricultural sciences, 12 Zhongguancun South Street, Beijing, China.