|  | 
 | |||
| 5mC Prediction Tool in Rice | |||||
| DNA 5mC has significant role in regulating gene expression and TE silencing in plants. 5mC has been located in all sequence contexts such as, CG, CHG and CHH (where H= A, T or C). In this SMEP, users could easily enquiry and predict the potential 5mC sites on targeted DNA regions. 
 | |||||
| Type/Paste the gene sequence with FASTA format below: | |||||
| Example: >test CCGGAGAGACAACGGGATCCAGGCGCCAGCGACGGATCCGGGATCTGCCGCCCACGACCCGAGTCATCGTTGGATCCACCACGTTGCCACTAGAGAATCTACCTGACATCCATTAGCTTTGATCCAAGAAAAAATTTGTAACAGGTATAAAATCACATCTTCATTAAAGTCAGCAGCCCACATCATCTCCAGGGCTGTTTTTCCCTCTAGCAAAAAGAACAGGTGCCAG Results | |||||
| Welcome to eLab in CAAS  | 
| Copyright©2018 eLAbcaas.cn All rights reserved. Design by  eLAbcaas.cn.
        
 |